Syvum Home Page

Home > Examinations > NYSED Regents Exams > Living Environment - High School > Print Preview

Living Environment - New York Regents January 2007 Exam

Formats View Examination Paper with Answers Solve Examination Paper Questions Review

Hide all answers   View all answers   Print   Try the Quiz

Part A
Answer all questions in this part. [30]
Directions (1-30): For each statement or question, identify the number of the word or expression that, of those given, best completes the statement or answers the question.

1. When brown tree snakes were accidentally introduced onto the island of Guam, they had no natural predators. These snakes sought out and ate many of the eggs of insect-eating birds. What probably occurred following the introduction of the brown tree snakes?
(1) The bird population increased.
(2) The insect population increased.
(3) The bird population began to seek a new food source.
(4) The insect population began to seek a new food source.

2. What will most likely happen to wastes containing nitrogen produced as a result of the breakdown of amino acids within liver cells of a mammal?
(1) They will be digested by enzymes in the stomach.
(2) They will be removed by the excretory system.
(3) They will be destroyed by specialized blood cells.
(4) They will be absorbed by mitochondria in nearby cells.

3. Which sequence represents the correct order of organization in complex organisms?
(1) tissues → organs → systems → cells
(2) organs → tissues → systems → cells
(3) systems → organs → cells → tissues
(4) cells → tissues → organs → systems

4. Which organelle is correctly paired with its specific function?
(1) cell membrane—storage of hereditary information
(2) chloroplast—transport of materials
(3) ribosome—synthesis of proteins
(4) vacuole—production of ATP

5. Homeostasis in unicellular organisms depends on the proper functioning of
(1) organelles
(2) insulin
(3) guard cells
(4) antibodies

6. Which statement best explains the change shown in the diagram below?

(1) Gene expression in an organism can be modified by interactions with the environment.
(2) Certain rabbits produce mutations that affect genes in specific areas of the body.
(3) Sorting and recombination of genes can be influenced by very cold temperatures.
(4) Molecular arrangement in existing proteins can be altered by environmental factors.

7. After a rabbit population reaches the carrying capacity of its habitat, the population of rabbits will most likely
(1) decrease, only
(2) increase, only
(3) alternately increase and decrease
(4) remain unchanged

8. Variation in the offspring of sexually reproducing organisms is the direct result of
(1) sorting and recombining of genes
(2) replication and cloning
(3) the need to adapt and maintain homeostasis
(4) overproduction of offspring and competition

9. An error in genetic information present in a body cell of a mammal would most likely produce
(1) rapid evolution of the organism in which the cell is found
(2) a mutation that will affect the synthesis of a certain protein in the cell
(3) an adaptation that will he passed on to other types of cells
(4) increased variation in the type of organelles present in the cell

10. Which process is illustrated in the diagram below?

(1) chromatography
(2) direct harvesting
(3) meiosis
(4) genetic engineering

11. Which statement is most closely related to the modern theory of evolution?
(1) Characteristics that are acquired during life are passed to offspring by sexual reproduction.
(2) Evolution is the result of mutations and recombination, only.
(3) Organisms best adapted to a changed environment are more likely to reproduce and pass their genes to offspring.
(4) Asexual reproduction increases the survival of species.

12. In 1993, there were only 30 panthers in Florida. They were all closely related and many had reproductive problems. To avoid extinction and restore health to the population, biologists introduced 8 female panthers from Texas. Today, there are more than 80 panthers in Florida and most individuals have healthy reproductive systems. The success of this program was most likely due to the fact that the introduced females
(1) produced more reproductive cells than the male panthers in Texas
(2) solved the reproductive problems of the species by asexual methods
(3) increased the genetic variability of the panther population in Florida
(4) mated only with panthers from Texas

13. The least genetic variation will probably be found in the offspring of organisms that reproduce using
(1) mitosis to produce a larger population
(2) meiosis to produce gametes
(3) fusion of eggs and sperm to produce zygotes
(4) internal fertilization to produce an embryo

14. Woolly mammoths became extinct thousands of years ago, while other species of mammals that existed at that time still exist today. These other species of mammals most likely exist today because, unlike the mammoths, they
(1) produced offspring that all had identical inheritable characteristics
(2) did not face a struggle for survival
(3) learned to migrate to new environments
(4) had certain inheritable traits that enabled them to survive

15. Marine sponges contain a biological catalyst that blocks a certain step in the separation of chromosomes. Which cellular process would be directly affected by this catalyst?
(1) mitosis
(2) diffusion
(3) respiration
(4) photosynthesis

16. A tree produces only seedless oranges. A small branch cut from this tree produces roots after it is planted in soil. When mature, this new tree will most likely produce
(1) oranges with seeds, only
(2) oranges Without seeds, only
(3) a majority of oranges with seeds and only a few oranges Without seeds
(4) oranges and other kinds of fruit

17. The diagram below represents a human reproductive system.

Meiosis occurs within structure
(1) A
(2) B
(3) C
(4) D

18. Which statement about embryonic organ development in humans is accurate?
(1) It is affected primarily by the eating habits and general health of the father.
(2) It may be affected by the diet and general health of the mother.
(3) It will not be affected by any medication taken by the mother in the second month of pregnancy.
(4) It is not affected by conditions outside the embryo.

19. Experiments revealed the following information about a certain molecule:
— It can be broken down into amino acids.
— It can break down proteins into amino acids.
— It is found in high concentrations in the small intestine of humans.
This molecule is most likely
(1) an enzyme
(2) an inorganic compound
(3) a hormone
(4) an antigen

20. The diagram below represents a structure involved in cellular respiration.

The release of which substance is represented by the arrows?
(1) glucose
(2) oxygen
(3) carbon dioxide
(4) DNA

21. Scientists have genetically altered a common virus so that it can destroy the most lethal type of brain tumor without harming the healthy tissue nearby. This technology is used for all of the following except
(1) treating the disease
(2) curing the disease
(3) controlling the disease
(4) diagnosing the disease

22. Many species of plants interact with harmless underground fungi. The fungi enable the plants to absorb certain essential minerals and the plants provide the fungi with carbohydrates and other nutrients. This describes an interaction between a
(1) parasite and its host
(2) predator and its prey
(3) scavenger and a decomposer
(4) producer and a consumer

23. In an ocean, the growth and survival of seaweed, small fish, and sharks depends on abiotic factors such as
(1) sunlight, temperature, and minerals
(2) sunlight, pH, and type of seaweed
(3) number of decomposers, carbon dioxide, and nitrogen
(4) number of herbivores, carbon, and food

24. A basketball player develops speed and power as a result of practice. This athletic ability will not be passed on to her offspring because
(1) muscle cells do not carry genetic information
(2) mutations that occur in body cells are not inherited
(3) gametes do not carry complete sets of genetic information
(4) base sequences in DNA are not affected by this activity

25. Carbon dioxide containing carbon-14 is introduced into a balanced aquarium ecosystem. After several weeks, carbon-14 will most likely be present in
(1) the plants, only
(2) the animals, only
(3) both the plants and animals
(4) neither the plants nor animals

26. Which situation is a result of human activities?
(1) decay of leaves in a forest adds to soil fertility
(2) acid rain in an area kills fish in a lake
(3) ecological succession following volcanic activity reestablishes an ecosystem
(4) natural selection on an island changes gene frequencies

27. Which human activity will most likely have a negative effect on global stability?
(1) decreasing water pollution levels
(2) increasing recycling programs
(3) decreasing habitat destruction
(4) increasing world population growth

28. Which process helps reduce global warming?
(1) decay
(2) industrialization
(3) photosynthesis
(4) burning

29. Which phrase belongs in box X of the flowchart below?

(I) Increased chance of cancer
(2) Increase in the production of functional gametes
(3) Decrease in genetic variability of offspring
(4) Decreased number of altered genes

30. The data in the table below indicate the presence of specific reproductive hormones in blood samples taken from three individuals. An X in the hormone column indicates a positive lab test for the appropriate levels necessary for normal reproductive functioning in that individual.

Which processes could occur in individual 3?
(1) production of sperm, only
(2) production of sperm and production of eggs
(3) production of eggs and embryonic development
(4) production of eggs, only

Part B-1
Answer all questions in this part. [13]
31. While viewing a specimen under high power of a compound light microscope, a student noticed that the specimen was out of focus. Which part of the microscope should the student turn to obtain a clearer image under high power?
(1) eyepiece
(2) coarse adjustment
(3) fine adjustment
(4) nosepiece

32. The diagram below shows the relative concentration of molecules inside and outside of a cell.

Which statement best describes the general direction of diffusion across the membrane of this cell?
(1) Glucose would diffuse into the cell.
(2) Protein would diffuse out of the cell.
(3) Carbon dioxide would diffuse out of the cell.
(4) Oxygen would diffuse into the cell.

33. Which statement most accurately describes scientific inquiry?
(1) It ignores information from other sources.
(2) It does not allow scientists to judge the reliability of their sources.
(3) It should never involve ethical decisions about the application of scientific knowledge.
(4) It may lead to explanations that combine data with what people already know about their surroundings.

34. The diagram below represents a pyramid of energy that includes both producers and consumers.

The greatest an amount of available energy is found at level
(1) 1
(2) 2
(3) 3
(4) 4

35. How much water should be removed from the graduated cylinder shown below to leave 5 milliliters of water in the cylinder?

(1) 6 mL
(2) 7 mL
(3) 11mL
(4) 12 mL

36. The diagram below represents a food web.

Two of the herbivores represented in this food web are
(1) toads and snakes
(2) deer and mice
(3) wolves and raccoons
(4) grasshoppers and toads

37. Compounds containing phosphorus that are dumped into the environment can upset ecosystems because phosphorus acts as a fertilizer. The graph be1ow shows measurements of phosphorus concentrations taken during the month of June at two sites from 1991 to 1997.

Which statement represents a valid inference based on information in the graph?
(1) There was no decrease in the amount of compounds containing phosphorus dumped at site 2 during the period from 1991 to 1997.
(2) Po1lution controls may have been put into operation at site 1 in 1995.
(3)There was most like1y no vegetation present near site 2 from 1993 to 1994.
(4) There was a greater variation in phosphorous concentration at site 1 than there was at site 2.

Base your answers to questions 38 and 39 on the diagram below and on your knowledge of biology. The diagram illustrates a process by which energy is released in organisms.

Nutrient Water (sugar) + Carbon dioxide Oxygen Energy
38. Cells usually transfer the energy that is released directly to
(1) glucose
(2) ATP
(3) oxygen
(4) enzymes

39. The energy released in this process was originally present in
(1) sunlight and then transferred to sugar
(2) sunlight and then transferred to oxygen
(3) the oxygen and then transferred to sugar
(4) the sugar and then transferred to oxygen

Base your answers to questions 40 on the diagram below and on your knowledge of biology.

40. The similarities of the bones labeled A provide evidence that
(1) the organisms may have evolved from a common ancestor
(2) all species have one kind of bone structure
(3) the cells of the bones contain the same type of mutations
(4) all structural characteristics are the same in animals

Part B-2
Answer all questions in this part. [15]
Base your answers to questions 41 and 42 on the information below and on your knowledge of biology.

A biology student was given three unlabeled jars of pond water from the same source, each containing a different type of mobile unicellular organism: euglena, ameba, and paramecium. The only information the student has is that the ameba and paramecium are both heterotrophs and the euglena can be either heterotrophic or autotrophic, depending on its environment.
41. State one way the euglena’s two methods of nutrition provide a survival advantage the other unicellular organisms do not have. [1]
Allow 1 credit for stating one way the euglena’s two methods of nutrition provide a survival advantage the other unicellular organisms do not have. Acceptable responses include, but are not limited to:
— It food is not available, the euglena can make its own food.

42. Which procedure and resulting observation would help identify the jar that contains the euglena?
(1) Expose only one side of each jar to light. After 24 hours, only in the jar containing euglena will most of organisms be seen on the darker side of the jar.
(2) Expose all sides of each jar to light. After 48 hours, the jar with the highest dissolved carbon dioxide content will contain the euglena.
(3) Over a period of one week, determine the method of reproduction used by each type of organism. If mitotic cell division is observed, the jar will contain euglena.
(4) Prepare a wet-mount slide of specimens from each jar and observe each slide with a compound light microscope. Only the euglena will have chloroplasts.

Base your answers to questions 43 through 46 on the passage below and on your knowledge of biology.

43. Identify the process that releases the nutrients from the bodies of the dead salmon, making the nutrients available for other organisms in the ecosystem. [1]
Allow 1 credit for identifying the process that releases the nutrients from the bodies of the dead salmon, making the nutrients available for other organisms in the ecosystem.
Acceptable responses include, but are not limited to:
— decomposition
— decay
— recycling

44. Identify one organism, other than the salmon, that would be present in or near the river that would most likely be part of a food web in the river ecosystem. [1]
Allow 1 credit for identifying one organism, other than the salmon, that would be present in or near the river that would most likely be part of a food web in the river ecosystem. Acceptable responses include, but are not limited to:
— decomposer/bacteria
— small fish
— seagulls
— green plant

45. Identify two nutrients that are returned to the ecosystem when the salmon die. [1]
Allow 1 credit for identifying two nutrients that are returned to the ecosystem when the salmon die. Acceptable responses include, but are not limited to:
— nitrogen compounds
— phosphorus compounds
— carbon compounds

46. State one impact, other than reducing the salmon population, that commercial ocean fishing has on the river ecosystem. [1]
Allow 1 credit for stating one impact, other than reducing the salmon population, that commercial ocean fishing has on the river ecosystem. Acceptable responses include, but are not limited to:
— Fishing deprives upstream ecosystems of nutrients.
— Consumers in the ecosystem would be deprived of food.
— Decomposer populations would decrease.
— disrupts food webs

Directions (47-49): Using the information in the data table, construct a line graph on the grid given below, following the directions below.

Biologists investigated the effect of the presence of aluminum ions on root tips of a variety of wheat. They removed 2-mm sections of the tips of roots. Half of the root tips were placed in a nutrient solution with aluminum ions, while the other half were placed in an identical nutrient solution without aluminum ions. The length of the root tips, in millimeters, was measured every hour for seven hours. The results are shown in the data table below.

47. Mark an appropriate scale on each labeled axis. [1]

Allow 1 credit for marking an appropriate scale on each labeled axis.
Note: Make no assumptions about the origin unless it is labeled.


Allow 1 credit for plotting the data for root tips in the solution with aluminum ions, surrounding each point with a small circle, and connecting the points.


Allow 1 credit for plotting the data for root tips in the solution without aluminum ions, surrounding each point with a small triangle, and connecting the points.

50. The aluminum ions most likely affected
(1) photosynthetic rate
(2) the union of gametes
(3) mitotic cell division
(4) starch absorption from the soil

51. Describe the effect of aluminum ions on the growth of the root tips of wheat. [1]
Allow 1 credit for describing the effect of aluminum ions on the growth of the root tips of wheat. Acceptable responses include, but are not limited to:
— Root tips grow less when exposed to aluminum ions.
— The growth of the root tips was stunted.
— Without aluminum ions, the root tips grow more.

Base your answers to questions 52 and 53 on the information below and on your knowledge of biology.

A pond in the Adirondack Mountains of New York State was once a fishing spot visited by many people. It was several acres in size, and fishermen in boats were a common sight. Over time, the pond has become smaller in area and depth. Places where there was once open water are now covered by grasses and shrubs. Around the edges of the pond there are cattails and other wetland plants.
52. Identify the ecological process responsible for the changes to this pond. [1]
Allow 1 credit for identifying the ecological process responsible for the changes to the pond as ecological succession or succession.

53. Predict what will most likely happen to this pond area over the next hundred years if this process continues. [1]
Allow 1 credit for predicting what will most likely happen to this pond area over the next hundred years if this process continues. Acceptable responses include, but are not limited to:
— The pond will probably be totally filled in.
— It may become a swampy area.
— It may become a forest.

Base your answers to questions 54 and 55 on the statement below and on your knowledge of biology.

The use of nuclear fuel can have positive and negative effects on an ecosystem.
54. State one positive effect on an ecosystem of using nuclear fuel to generate electricity. [1]
Allow 1 credit for stating one positive effect on an ecosystem of using nuclear fuel to generate electricity. Acceptable responses include, but are not limited to:
— There is little air pollution from nuclear fuels.
— It doesn’t contribute to acid rain.
— It doesn’t use fossil fuels.
— It doesn’t contribute to global warming by releasing CO2.

55. State one negative effect on an ecosystem of using nuclear fuel to generate electricity. [1]
Allow 1 credit for stating one negative effect on an ecosystem of using nuclear fuel to generate electricity. Acceptable responses include, but are not limited to:
— results in nuclear waste
— dangers from radiation
— thermal pollution

Part C
Answer all questions in this part. [17]
Base your answers to questions 56 and 57 on the statement below and on your knowledge of biology.

Selective breeding has been used to improve the racing ability of horses.
56. Define selective breeding and state how it would be used to improve the racing ability of horses. [2]
Allow a maximum of 2 credits, 1 credit for defining selective breeding and 1 credit for stating how it would be used to improve the racing ability of horses.
Example of a 2-credit response: Choose parents with the desired trait to breed. A fast male horse is bred to a fast female horse and the offspring may inherit the fast-running traits of both parents.

57. State one disadvantage of selective breeding. [1]
Allow 1 credit for stating one disadvantage of selective breeding. Acceptable responses include, but are not limited to:
— Undesirable traits of parents may be expressed in the offspring.
— unexpected combinations of genes
— unpredictable results
— decreased variation in race horses

58. State one specific way the removal of trees from an area has had a negative impact on the environment. [1]
Allow 1 credit for stating one specific way the removal of trees from an area has had a negative impact on the environment. Acceptable responses include, but are not limited to:
— Less oxygen is produced.
— Less carbon dioxide is removed from the atmosphere.
— Habitats are destroyed.
— Biodiversity is diminished.
— Plant species valued for medicines are lost.
— affects global temperatures
— increased erosion

Base your answers to questions 59 through 61 on the information below and on your knowledge of biology.

     It has been discovered that plants utilize chemical signals for communication. Some of these chemicals are released from leaves, fruits, and flowers and play various roles in plant development, survival, and gene expression. For example, bean plant leaves infested with spider mites release chemicals that result in an increase in the resistance to spider mites in uninfested leaves on the same plant and the expression of self-defense genes in uninfested bean plants nearby.
Plants can also communicate with insects. For example, corn, cotton, and tobacco under attack by caterpillars release chemical signals that simultaneously attract parasitic wasps to destroy the caterpillars and discourage moths from laying their eggs on the plants.
59. Identify the specialized structures in the cell membrane that are involved in communication. [1]
Allow 1 credit for identifying the specialized structures in the cell membrane that are involved in communication. Acceptable responses include, but are not limited to:
— receptors
— receptor molecules

60. Explain why chemicals released from one plant species may not cause a response in a different plant species. [1]
Allow 1 credit for explaining why chemicals released from one plant species may not cause a response in a different plant species. Acceptable responses include, but are not limited to:
— Receptors are specialized.
— The chemicals released by one plant species may not be recognized by the receptors of another plant species.
— Genetic differences between the two plant species may limit responses to specific chemicals.

61. State two advantages of relying on chemicals released by plants rather than using man-made chemicals for insect control. [2]
Allow a maximum of 2 credits, 1 for each of two advantages of relying on chemicals released by plants rather than using man-made chemicals for insect control. Acceptable responses include, but are not limited to:
— less harmful to the environment
— cheaper
— do not cause pollution

Base your answers to questions 62 through 64 on the information below and on your knowledge of biology.

Cells of the immune system and the endocrine system of the human body contribute to the maintenance of homeostasis. The methods and materials these two systems use as they carry out this critical function are different.
62. State two ways cells of the immune system fight disease. [2]
Allow a maximum of 2 credits, 1 credit for each of two ways cells of the immune system fight disease. Acceptable responses include, but are not limited to:
— engulf foreign substances
— produce antibodies
— recognize pathogens/antigens

63. Identify the substance produced by the cells of all the endocrine glands that helps maintain homeostasis. [1]
Allow 1 credit for identifying hormones as the substance produced by the cells of all the endocrine glands that helps maintain homeostasis.

64. Identify one specific product of one of the endocrine glands and state how it aids in the maintenance of homeostasis. [1]
Allow 1 credit for identifying one specific product of one of the endocrine glands and stating how it aids in the maintenance of homeostasis. Acceptable responses include, but are not limited to:
— Insulin regulates blood sugar levels.
— Estrogen or testosterone regulates the reproductive system.

65. A certain plant has white flower petals and it usually grows in soil that is slightly basic. Sometimes the plant produces flowers with red petals. A company that sells the plant wants to know if soil pH affects the color of the petals in this plant. Design a controlled experiment to determine if soil pH affects petal color. In your experimental design be sure to:
• state the hypothesis to be tested in the experiment [1]
• state one way the control group will be treated differently from the experimental group [1]
• identify two factors that must be kept the same in both the control group and the experimental group [1]
• identify the dependent variable in the experiment [1]
• state one result of the experiment that would support the hypothesis [1]
Allow a maximum of 5 credits for designing a controlled experiment to determine if soil pH affects petal color, allocated as follows:
• Allow 1 credit for stating the hypothesis to be tested. Acceptable responses include, but are not limited to:
— Soil pH affects flower (petal) color.
Note: Do not allow credit for a hypothesis in the form of a question.
• Allow 1 credit for stating one way the control group will be treated differently from the experimental group. Acceptable responses include, but are not limited to:
— The control group will be planted in soil that is slightly basic. The experimental groups will be planted in soil that has a pH that is not slightly basic.
— The experimental group will be grown in acidic soil. The control group will be grown in nonacidic soil.
• Allow 1 credit for identifying two factors that must be kept the same in both the control group and the experimental group. Acceptable responses include, but are not limited to:
— amount of soil
— amount of water
— amount of light
— temperature
• Allow 1 credit for identifying the dependent variable as petal color or flower color.
• Allow 1 credit for stating one result of the experiment that would support the hypothesis. Acceptable responses include, but are not limited to:
— Red flowers appear on the plants that grow in soil that is not slightly basic.
— Plants grown in acidic soil have red flowers.

Part D
Answer all questions in this part. [13]
Base your answers to questions 66 and 67 on the information and the data table below and on your knowledge of biology.

Two students collected data on their pulse rates while performing different activities. Their average results are shown in the data table below.

66. State the relationship between activity and pulse rate. [1]
Allow 1 credit for stating the relationship between activity and pulse rate. Acceptable responses include, but are not limited to:
— As activity increases, so does the pulse rate.
— The pulse rate increases as the activity increases.

67. State one way that this investigation could be improved. [1]
Allow 1 credit for stating one way that this investigation could be improved. Acceptable responses include, but are not limited to:
— larger sample size
— repeat the investigation

Base your answers to questions 68 through 71 on the information below and on your knowledge of biology.

To demonstrate techniques used in DNA analysis, a student was given two paper strip samples of DNA. The two DNA samples are shown below.
Sample 2: ATTCCCGTAATCCCGTAATGCCCGATAATACTCCGGTAATATC The student cut between the C and C in each of the shaded CCGC sequences in sample 1 and between the As in each of the shaded TAAT sequences in sample 2. Both sets of fragments were then arranged on a paper model of a gel.
68. The action of what kind of molecules was being demonstrated when the DNA samples were cut? [1]
Allow 1 credit for identifying the kind of molecules whose action was being demonstrated when the DNA samples were cut. Acceptable responses include, but are not limited to:
— enzymes
— restriction enzymes
— proteins
— biological catalysts

69. Identify the technique that was being demonstrated when the fragments were arranged on the gel model. [1]
Allow 1 credit for electrophoresis or gel electrophoresis.

70. The results of this type of DNA analysis are often used to help determine
(1) the number of DNA molecules in an organism
(2) if two species are closely related
(3)the number of mRNA molecules in DNA
(4) if two organisms contain carbohydrate molecules

71. State one way that the arrangement of the two samples on the gel model would differ. [1]
Allow 1 credit for stating one way that the arrangement of the two samples on the gel model would differ. Acceptable responses include, but are not limited to:
— The number of bands would differ.
— The bands would be in different positions.
— The banding patterns would be different.

Base your answers to questions 72 and 73 on the information below and on your knowledge of biology.

In birds, the ability to crush and eat seeds is related to the size, shape, and thickness of the beak. Birds with larger, thicker beaks are better adapted to crush and open seeds that are larger. One species of bird found in the Galapagos Islands is the medium ground finch. It is easier for most of the medium ground finches to pick up and crack open smaller seeds rather than larger seeds. When food is scarce, some of the birds have been observed eating larger seeds.
72. Describe one change in beak characteristics that would most likely occur in the medium ground finch population after many generations when an environmental change results in a permanent shortage of small seeds. [1]
Allow 1 credit for describing one change in beak characteristics that would most likely occur in the medium ground finch population after many generations when an environmental change results in a permanent shortage of small seeds. Acceptable responses include, but are not limited to:
— Beaks would be thicker.
— Birds with larger, thicker beaks would become more common in the population than those with the original beak characteristics.

73. Explain this long-term change in beak characteristics using the concepts of
• competition [1]
• survival of the fittest [1]
• inheritance [1]
Allow a maximum of 3 credits for explaining the long-term change in beak characteristics, allocated as follows:
• Allow 1 credit for including the concept of competition.
• Allow 1 credit for including the concept of survival of the fittest.
• Allow 1 credit for including the concept of inheritance.
Example of a 3-credit response: Competition for food would increase as small seeds became scarce. Birds with larger, thicker beaks would have a better chance of surviving when the seeds were larger and tougher to crack. Birds with normal thickness beaks would be less likely to survive. Reproduction of the surviving birds, many with the larger, thicker beaks, would produce more offspring inheriting the better adapted beak type. Over time, this would lead to a large proportion of the population having the thicker beaks.

Base your answers to questions 74 and 75 on the information and diagram below and on your knowledge of biology. The diagram represents some cells on a microscope slide before and after a substance was added to the slide.

74. Identify a substance that was most likely added to the slide to cause the change observed. [1]
Allow 1 credit for identifying a substance that was most likely added to the slide to cause the change observed. Acceptable responses include, but are not limited to:
— salt solution
— salt water
— salt

75. Describe a procedure that could be used to add this substance to the cells on the slide without removing the coverslip. [1]
Allow 1 credit for describing a procedure that could be used to add this substance to the cells on the slide without removing the coverslip. Acceptable responses include, but are not limited to:
— Put a piece of paper towel on one edge of the coverslip and add the substance to the opposite edge of the coverslip one drop at a time. Add more drops as the paper towel soaks up the liquid from under the slide.

76. In the Diffusion Through a Membrane lab, the model cell membranes allowed certain substances to pass through based on which characteristic of the diffusing substance?
(1) size
(2) shape
(3) color
(4) temperature

  Try the Quiz :     Living Environment - New York Regents January 2007 Exam

Contact Info © 1999-2018 Syvum Technologies Inc. Privacy Policy Disclaimer and Copyright